One night the mirror people invaded the earth. Their power was great, but at the end of bloody warfare the magic arts of the Yellow Emperor prevailed. He repulsed the invaders, imprisoned them in their mirrors, and forced on them the task of repeating, as though in a kind of dream, all the actions of men. He stripped them of their power and of their forms and reduced them to mere slavish reflections. Nonetheless, a day will come when the magic spell will be shaken off.

Jorge Luis Borges, passage from “The Fauna of Mirrors”, from The Book of Imaginary Beings

Re-Merz City

I went to look after Orhan Pamuk’s Istanbul; Memory and the City but found myself in Borges´ “The Fauna of Mirrors”.

Still, Pamuk starts his Istanbul with the quote by Ahmet Rasim which is still present in some corners : “The beauty of the landscape resides in its melancholy”

However, the overall frame of the project is built on some particular local Istanbul issues and yet I would rather say that the city itself was more of a “study case” of urban development, biopower and perception of reality.

I am taking the Borges fable literally but what I am creating is more of a metaphoric portrait of mechanisms of inclusion and exclusion and the thin line in-between which keeps the machinery running

AFTERWORD

“I think that a confrontation with metropolitan dispositifs will only be possible when we penetrate the processes of subjectivation that the metropolis entails in a more articulated way, deeper. Because I think that the outcome of conflicts depends on this: on the power to act and intervene on processes of subjectivation, in order to reach that stage that I would call a point of ungovernability. The ungovernable where power can shipwreck in its figure of government, the ungovernable that I think is always the beginning and the line of flight of all politics.”

“Metropolis” Georgio Agamben

ᴛʜᴇ ʟᴏᴠɪɴɢ ꜰᴀɴᴛᴀꜱy ɪɴᴛᴇɴᴛɪᴏɴᴀʟʟy ꜰᴏʀɢᴇᴛꜱ ᴛʜᴇ ᴛᴏᴡᴇʀ.

ᴛʜᴇ ᴇɴʟɪɢʜᴛᴇɴᴇᴅ ᴩyʀᴀᴍɪᴅ qᴜɪᴇᴛʟy ᴅᴇꜱɪʀᴇꜱ ᴛʜᴇ ᴄᴀꜱᴛʟᴇ.

ᴏᴏʜ, ʟɪᴍᴇʀᴇɴᴄᴇ! ᴛʜᴇ ᴍᴏᴏɴ ɪꜱ ᴀ ᴛᴏᴡᴇʀ ᴏꜰ ꜰᴀɪᴛʜ.

ꜱᴏᴄɪᴇᴛyꜱ ɢʀᴏᴡ ʟɪᴋᴇ ɪɴꜰᴀᴛᴜᴀᴛᴇᴅ ʙʟᴜᴇʙᴇʀʀɪᴇꜱꜱ.

Artistic research on the notion of a young African nation, and it´s archive history linked to moving imagery, by using it´s state channel as one entry level.
Project description:
Looking into a young African nation: Eritrea´s archive history, before and after it´s independence ´91, using new media: Eri tv, the state channel as an entry level.
Using question such as :
What does it mean to build up a new nation, a countries identity using moving images and sound?
How does the body/the people record/archive, linked to memories?
What is activated when one connect people, memories, experiences of the past, using moving images as a language? How does it tell or even re-create a new national history?Looking into the meaning of an “independent state”, with moving images.
What does a state channel mean for it´s future history, its people and what form of language is used with imagery? What kind of political structure may moving images hold?
What may be the danger/possibilities in using such form of “representation” linked to new media?

The project seeks to investigate what kind of mechanisms would countries with different political situation, such as many young african nation today use, in creating or revisiting an archival language, by using for example, moving imagery and audio as tools.

Using excerpt from new interviews and old recordings, on what impact the state channel ( in the early 90´s) had on the different people of Eritrea. i.e its different nine ethnic tribes. Such as hearing their local language Tigrynyia for the first time on air, after independence´91. Before Eritrea was part of Ethiopia, the ruling state, (language Amharic) and later the former colonial power (Italy/Italian). The country would be known in the future as Eritrea, but at the time in the local tongue, it was called Mdree-Bahree-Land of the Sea.
Eritrea have had a military run government since ´91. This may be a cause to a longer after effect of the countries Italian colonial history, that rose to heights especially in the 30´s and the national state channel Eri Tv is somewhat used as an educational tool, using the countries past and present history told with moving imagery, today.

The project also seek to instigate an alternative and interdisciplinary dialogue on archiving and looking into how to read/interpret, or revisit different archives by focusing on the moving images producing meaning and also a history of archives linked to it´s time – with its memories, political landscape, cartographies, and affective potential the project hopes to play a critical actor in the work of examining how one understands archival imagery and possibly also a historical recovery by using archives as a medium.

Video: Mdree-Bahree-Land of the Sea  
Excerpt from the dialogue:
___There is no escaping popular culture, if you´re living in a western society.
If you look at a national charter, cultural revival is Its key component….and then on going. There´s high value placed on It.
Products of the west… I mean when one is sitting there watching CNN, BBC and MTV. If you then put on Eri TV. It´s the other end of the spectrum. To the degree, I mean you don´t even identify with it. Even though It´s yours. 
In terms of It´s your language, your production, and It´s been beamed globally, from back home.
_Then again, you have to take in all the factors to why the influence of present perspective or consumption of It, as a medium or as a medium out-letter and appreciate It´s share existence. I link that to the course of history, who we are and how we came about. And there are loads of people that just make fun of It. Or you know, they would not blink an eye at It. And I also understand towards why.
_There´s not an official language of Eritrea. The working language is Tigrinya, Arabic and English. There is not an actual official language of the country. That´s because of the composition of the people, of the population in the nine ethnic tribes. It would be wrong to say. Any give one is a national language. In terms of Tv, how Its presented or represented in the media across Europe, America, and the rest of the world is always debatable.

Yeah, I guess.. Its experience…comes with age as well. You learned English in Europe or?
__ Well, obviously..I did, but I have no recollection of It. 
Like I mentioned earlier. I´ve got too many friends that I see grow up here alone, and there is a very strong direct correlation between how the households are or how the different kids/siblings grow, or the family value splits. 

She´s the second generation, Right?
__Yeah…But they are not really religious, since they were all raised like that.
In time, you acknowledge more where It all started.

So he would have knowledge of the Italians being or coming to Eritrea?
___ Yeah, vaguely. I mean he was born in ´42. I mean he speaks fluent Italian.
That generation of Eritreans, many do. 

Yeah?
__ Because of the influence of colonialism it sticks. You would have to look at west Africa as a whole.  I mean if you look at countries like, Chad, Nigeria, Ivory Coast, Sierra Leone, and then you got central Africa, they all speak french. It´s the working language. It is what they still teach in school. These are the effects of imperialism. 

How do you see that as teacher working in Britain?
Is imperialism a word that´s being used in the curriculum?
__ No, not really. In a way Its not part of their agenda. 
When we talk about imperialism you often think about a British empire, but before that, one have to talk about Eurocentrism as a term. 

Do you feel people know the definition of what that is when you talk to your younger student or even other teachers?
__ No, not really. I´m always in the staffroom battling social science and history departments, alone. Haha. Yeah, I guess every country has a different agenda. 

LYRICS

CONCEPTS OF RESISTANCE FROM 25 YEARS AGO

ARE SWALLOWED BY WALLPAPERS

HAPPENS ALL THE TIME

YOUTH IS CELEBRATED MOSTLY IF IT STAYS YOUNG

ONLY TO BECOME A BACKDROP

WALLPAPERING OVER DECAY

POST-AUTHENTIC BLUES

——————–

shy away from bended neon of fraudulent bogus

have more faith in the words of handwritten italics

shy away from upscale oil of a daunting elite

have more faith in the stroke of a brush of acrylics

shy away from the charades of poets of pretenses

have more faith in the sound of rhyming poetics

shy away from dictating regimes of the west

don’t let them tell you what is best

—————————

THE PAIN IS MOST PRESENT

IT’S THE ONLY SIGN OF LIVING

REDEMPTION IS ONLY FOR THE FEW

ALONE AND NUMB

IS WHAT WE’VE BECOME

IT’S ONLY ATTRACTIVE WHEN IT’S NEW

ALL THAT IS ANTI

IS ABSORBED BY THE BIG LIE

IT’S FUNNY BECAUSE IT IS TRUE

——————–

“grunge girl”

neither male nor female

will not be defined

neither fresh nor stale

don’t make up your mind

only young when wished for

age is hardly real

only thing that matters

is how you really feel

wretchedly reclaiming

what was once our time

hypocrisy is stealing

one moment at a time

————————

IMMENSE IS THE ABSORPTION

DESERTION IS BEYOND THE POSSIBLE

SHE HIDES IN THE SHADOW

BEHIND AN EYE EVER SO VEILED

————————-

Heavy is the slightest sigh

lightest might be the last goodbye

to flee from where we came

that is our mission every day

to the grave of the dying

love is a pillow on which we’re crying

life is a series of continuous goodbyes

For AFGANG 2015 I am showing a digital image encoded in DNA. In the exhibition there is a container with 37 mg isolated DNA as well as a projection of the image stored in DNA.
The image shows a pixelated b/w landscape saved as a highly compressed JPEG. It has a small number of pixels and only takes up 884 bytes. It is composed of thousands of pixels made by resizing digital photos to a single b/w pixel. In this reduction close to all visible information is lost and left is only the amount of light captured by the cameras. Still, a large number of circumstances have determined the exact grey tone of the pixel, but none of them can be traced back.
All the photos were captured between 2003 and 2015 by digital cameras I have owned.

Encoding digital information in DNA:

The idea of storing non-biological information in DNA dates back more than 50 years but was not actualised before 1988 when artist Joe Davis encoded a 35 bit icon in 28 base pairs of DNA. i
Jumping to 2012 George M. Church and his team managed to encode and read back 5.27 megabit (around 659 kilobytes) including digital photos, text and a Javascript. This was the first time more than a kilobyte was stored in DNA. ii
Later in 2013 Nick Goldman and his team stored a similar amount of information and published an improved DNA-storage method that should be possible to scale up beyond current information volumes. The publication also offered a new system of error-correction.iii

The general idea of translating binary code into a DNA sequence is relatively simple.
As known binary information consists of zeros and ones and DNA consists of 4 bases: A, C, G and T.
Lets say we want to translate 3 bytes: 00011011 10001101 00001111
One possibility is to decide that A and C equals zero and G and T equals one. 
Now 1 base in DNA holds the same information as 1 bit.
The 3 bytes could now look like this: ACAGTCGT GACATGCT ACACGTGT
An other possibility is to decide that A = 00, C = 01, G = 10 and T = 11.
 Now 1 base in DNA will hold the same information as 2 bits.
The sequence will now be the following: ACGT GATC AATT

In practice the process is much more complicated and requires a lot of technical knowledge. I collaborated with two friends, Hans Jasper Genee and Lars Rønn Olsen, who works with bioengineering and bioinformatics.
 We first hoped to store the image in a single string of DNA and then amplify it to the largest possible number of copies. It turned out to be very difficult to synthesize a DNA string of more than 1000 base pairs (bp) as the complexity of the coding grows rapidly. In order to synthesize a DNA sequence it has to be without repetition, which is hard to avoid when the information is translated from a binary code.
In the end we used a method similar to what Nick Goldman published in 2013. We translated 7072 bits into 76 DNA sequences of roughly 60 bp – in total 4525 bp. For practical reasons we did not index the sequences or use a system for error-correction – so reading back the information will be a challenge but should however be possibly.
The 76 DNA sequences were send to a lab in Belgium that synthesized the DNA. We received the fragments of DNA in 76 containers. In a laboratory we dissolved the DNA fragments in water and mixed them together. When the water evaporated the DNA had crystallised.

Even though the DNA only has a mass of 37 mg it contains around 20 Quadrillion (10^15) copies of the digital image. If the same number of copies of the binary code were to be stored it would take up more than 17 million terabyte.
If the DNA is kept dry and cold it will be preserved for a long time. If stored in a synthetic fossil it can last for 2000 year in normal temperatures or more than a million years at -18°C. iv

i http://blogs.scientificamerican.com/oscillator/dna-code/

ii Next-Generation Digital Information Storage in DNA – George M. Church, Yuan Gao & Sriram Kosuri

iii Towards practical, high-capacity, low-maintenance information storage in synthesized DNA – Nick Goldman, Paul Bertone, Siyuan Chen, Christophe Dessimoz, Emily M. LeProust, Botond Sipos & Ewan Birney

iv Robust Chemical Preservation of Digital Information on DNA in Silica with Error-Correcting Codes – Robert N. Grass, Reinhard Heckel, Michela Puddu, Daniela Paunescu1 & Wendelin J. Stark

Meta data:
156 GB: 39.578 digital photos captured from 2003 to 2015 by 16 digital cameras.
523.6 MB: 39.578 image files with 1 b/w pixel
2.4 MB: 1 PSD file with 39.578 pixel imported
884 B: 1 JPEG, 128 x 72 pixel

4525 bp: 1 JPEG, 128 x 72 pixel
8,91425 x 10^19 bp: 20 x 10^15 copies of 1 JPEG, 128 x 72 pixel
37 mg isolated DNA (2 mg used for samples)

Binary code:
11111111 11011000 11111111 11100000 00000000 00010000 01001010 01000110 01001001 01000110 00000000 00000001 00000001 00000001 00000000 01001000 00000000 01001000 00000000 00000000 11111111 11011011 00000000 01000011 00000000 00010000 00001011 00001100 00001110 00001100 00001010 00010000 00001110 00001101 00001110 00010010 00010001 00010000 00010011 00011000 00101000 00011010 00011000 00010110 00010110 00011000 00110001 00100011 00100101 00011101 00101000 00111010 00110011 00111101 00111100 00111001 00110011 00111000 00110111 01000000 01001000 01011100 01001110 01000000 01000100 01010111 01000101 00110111 00111000 01010000 01101101 01010001 01010111 01011111 01100010 01100111 01101000 01100111 00111110 01001101 01110001 01111001 01110000 01100100 01111000 01011100 01100101 01100111 01100011 11111111 11000000 00000000 00001011 00001000 00000000 01001000 00000000 10000000 00000001 00000001 00010001 00000000 11111111 11000100 00000000 00011011 00000000 00000000 00000011 00000001 00000001 00000001 00000001 00000001 00000000 00000000 00000000 00000000 00000000 00000000 00000000 00000000 00000000 00000000 00000010 00000011 00000100 00000001 00000101 00000110 00000111 11111111 11000100 00000000 00111110 00010000 00000000 00000001 00000010 00000011 00000101 00000001 00001011 00001010 00000101 00000101 00000000 00000000 00000000 00000000 00000000 00000000 00000010 00000000 00000011 00010010 00010011 00100010 00000001 00000100 00110010 01000010 11110000 00100011 00010001 00010100 00100001 01000001 01010010 01100001 01100010 01110010 10010001 10110001 11010001 00000101 00110001 00110011 01000011 01010001 10000001 10000010 10010010 10100010 10110010 01100011 01110001 10000011 10100001 11110001 01000100 01010011 10100011 11000001 11010010 11111111 11011010 00000000 00001000 00000001 00000001 00000000 00000000 00111111 00000000 11111001 11100001 10000001 10111011 10111110 11001011 00101001 10001101 00011111 00000101 10001011 00001010 01000100 00100001 00001001 11010000 10000101 01011001 01101011 11010001 00010111 00110011 10101110 11011101 10011011 00111100 10011000 11010110 11000001 00010000 10010111 01000011 10110100 01101011 01011111 10010010 10101000 10001100 01010100 01100111 11100100 00101111 01110111 11001001 10000011 10110011 01101101 01111010 10001101 00111001 10110011 01011111 10011001 00111011 10110000 10111011 10110110 11010110 01110010 10000110 00001110 11001101 01111110 11001010 00001010 01100100 10100110 10000100 11110000 10100001 00111100 10110101 01010110 10011011 01011010 10011010 11011010 10101110 10101101 01101101 00110111 00010101 01111000 00000011 11011111 10001011 11011000 10011010 01011011 00100011 11101011 01111011 11010110 10001000 01000000 10101011 00000111 01110000 11111100 11010000 11101011 01110011 10110101 01111010 10111110 01001100 00100101 00010001 01110000 11010111 11001010 01011110 11011011 10110000 00101111 10001100 00000011 01010100 01000011 00001111 01110110 11101101 10111111 01010110 11101111 11111010 11100000 01010000 01000010 10010010 11101100 10110101 11000100 11110010 11010011 01001011 01001110 11010011 01101011 01001010 11010100 01010000 01001011 10000001 01001100 01100011 00011010 00010101 01001000 10000010 01011100 00000111 10001111 10101111 01001110 10110101 11001100 10101000 01010001 10001101 00011001 11000101 00111100 11000100 01001100 01011110 01110011 11100010 01100101 11100101 00001010 11101011 00110001 10010111 00000101 01111101 00001011 00111011 10101100 01010000 01000010 11001000 10101010 10011101 10100110 11010011 10101101 01110010 11100101 00101101 10100010 00110001 01010000 10110010 10010011 01110010 10101000 00111010 00100001 01010011 01010111 00100010 00001001 01110000 00011110 00111110 10111101 00111010 11010111 00110010 11001110 11010001 00000100 11001000 11000001 00101011 10101111 00100110 10011110 10001001 11101010 00001100 00111001 00001101 11100010 11110000 01100110 11010110 00010000 11111001 01111100 11001000 01100010 00001101 11101111 00110111 10100001 11010101 11100010 01011100 01101001 11000011 00101011 11000011 10000000 01111100 10111111 11100001 01001101 10101001 11001101 01111010 00010100 01001011 01111001 11010101 10110010 01011011 00101110 11011101 11010001 00101110 01010111 11101001 00100100 10011001 00110111 01100100 10011101 10001101 10101110 11111000 10010010 10110110 10111110 11110000 01100011 11111011 00110101 10101110 00000101 11100100 00010101 11100100 00111110 00111100 10001000 00010111 10001101 11010111 00110110 11001010 01100100 11100100 00101011 10010011 10010001 00110001 00010011 10010101 11011010 01101100 00100110 01011111 00111001 01100000 00011111 00110010 11011110 11001101 11001100 00101101 00001001 01000110 11101011 10010100 11101100 10001110 00001100 00110100 11010011 10101110 00000101 00101001 00101100 11110101 00110101 11000111 10111000 01011010 11110111 10101110 10001011 01100110 00111111 11010100 11000111 11010100 00001100 00111101 10110110 11110000 10101010 10001011 01101100 10111011 11101001 10011101 11111111 00000000 00001101 10111101 11111011 10101001 10001000 10101110 11000010 11011100 00001100 10111011 00011111 01011100 00101101 11110001 01011001 11000100 01001111 00011110 11010011 11111000 01011000 11011101 10111101 10000011 01010100 00000101 01100111 11110100 10101000 00001001 00011001 01011110 00100011 01111011 00011110 10111101 10001011 10100101 10111001 10000000 01101111 00101100 00000000 00001111 01011101 01110000 10000100 10001101 11001000 00000010 11111100 11000001 11000101 11010111 11111111 00000000 10010101 11010111 11000100 11000001 11000111 00001011 00100100 01100110 00100011 10001111 11011111 11011001 11100110 01011001 11100010 01000100 01001000 10001001 00010001 00101111 01000010 00011000 10100110 01011110 00100110 11010001 01001100 00011101 00101010 00001011 11000011 10001101 01001000 01011110 00110110 00011011 01101100 00000001 11001010 00111100 01101100 10110010 11011110 01111110 01111110 00100101 00111101 11110010 11110110 01111111 10110000 00111011 11010111 00001010 11111110 11110001 01001100 10000010 10011000 10111111 00000100 01111100 00010010 10001101 11100101 11010010 10100000 10100100 01100010 11100100 01011001 10101110 11000100 01101111 10010111 10001010 10001010 00000011 11110100 01101100 01001010 00100100 01111001 11011101 11111010 11101100 11110001 01010111 00100111 11011110 11011001 10000110 11111001 10100000 01111110 11010100 10000010 11100110 11010011 11010010 00000001 11011001 10101110 00101011 01110111 01110101 11000000 10010100 10001001 10011001 10011110 10101111 10101111 10101110 00000101 00000010 00011000 01110000 00111011 00011010 00001000 10001100 01110001 10100100 10001001 00010001 00100010 00100100 01000100 10111101 01100001 00010000 01101010 01100011 01011001 11110110 01111001 00111111 00001110 11011111 00011101 01110001 11100011 00100110 11011110 00011100 00011000 00100000 00011100 11111100 11011111 10011101 10001010 00000100 00101111 00010111 10101010 01110011 11110111 01000100 10110111 01011010 10101000 11011010 10100111 10100110 00010110 10100101 10011000 01111000 00000001 11011010 00010111 00001000 10001111 00111010 00000100 10111001 00001011 10110011 00001101 00100001 00010100 01001001 11100001 10000101 10110100 10110110 00010001 00001000 01010101 11100110 01011100 00100010 00000100 01000100 10001000 10010001 00010010 00100010 01011110 11111000 10001000 11101111 11000111 00001011 10010101 01010001 01110111 01110111 00101100 11001110 10010100 01011011 01010000 01110010 10001000 00000111 10111001 01001001 10100111 00001100 10101111 00011111 00011010 10111000 10001110 01000100 10110000 11100111 11000111 01011010 00001001 10110000 00101011 10111011 10011011 00111100 10001010 01000101 01110110 01100111 11111011 01011111 01011101 10101001 00001010 11100100 01110010 11100011 00000111 01011011 11111000 11110101 01101010 10000001 01011101 11001100 01101011 11011001 10011010 10000110 00010111 00010000 10001000 10010001 00010010 00100010 01000100 01001001 01010111 11111111 11011001

DNA sequences:
1: TCTGCGATACAGATGAGATCATGTCACTAGCTGCGACAGCACGACTATCATGCGACGACG
2: TAGTACGACGCATAGCGAGTGCACTGTCTATGCGATGCGATCTGCTAGTGCATAGACAGA
3: TGCGATAGTCATGATGATACTCGACGATACTGCGTCACTAGACTACGCGCTCGACGATCA
4: CTGCTCACTAGAGAGATACATCATGTGAGAGCGTGCACATATATGTGTATGTCGAGTGCA
5: GCTATCATGCGCTGCACACGCTAGACATGCACGTACATATAGACTCGCGCACTGCAGATA
6: CTGATAGACTATACTATGTACTGATCGTCAGCATGATCGCATCTGTGCGAGCGAGAGTGA
7: GATCATCATGAGCGATGTCGTGACATATACGCTATGCAGCGTCAGACTAGCATGAGAGCT
8: ATGCTACTACACTATACACGTCGCTATACGATGAGCACTGTCATGTCATGATGCACGCAT
9: GTCACTCGCATAGTGTACGTCGTACTACTGCTCATGTCAGATGCGATCATGTCGTGCTGC
10: ACTGCACTACAGACGACGTAGTACGACGTAGTACGACGCATAGCATAGCATAGCATAGCA
11: TAGCATAGCATAGCATAGCATAGCATAGAGCACGTGAGCGCATACTACGTGCACATCTGC
12: AGACAGATGCGATCATGTCATGATATAGTCATGTCGTCGTCTGCGTATCTACATGTAGTA
13: TGCTGCATACTACATGTATGCATGTCATGTCATGTCATGTCATGTCATGTCTCATATGCG
14: ACGCTCTGATAGAGAGCACTCGTCGTGTGCAGAGTCACTACTGCGACATGAGCAGATCAG
15: AGTAGACACATGAGTACTCTGCACTAGTCGAGAGCGCTGTGATACGTATGCGACTCGAGT
16: GACAGAGATCAGTACGCGAGATAGTGCGCTCTATCGTACTGTCGATACAGCATAGCTCGT
17: ATCGTCTGCTATCACTACGTCTGACGCTCATCGATCATGTCATACACGACGTAGTATGCG
18: ATGCGATCGACATGTCGCGCGACGTCTACGTACTCACTGCAGAGATGCTCGAGCGCGTAG
19: TACATGACGCTGCGTCAGTAGACGAGTGACGCGATATCTCAGCTAGAGACGATACGTAGC
20: ACTCGCTGAGTACGCGTCGTGTACATGCATGAGCACGTACGATAGTCAGACAGTGAGTGT
21: CAGAGTAGATAGCGACATACGCTGCTGCGAGCGCTATGCAGCTATCATACACTAGTCGTA
22: TCAGTAGTCTATCATGCACTCACACACTCTACTAGATAGAGTGTGCACAGTATACGTCTG
23: ATATGATGTAGTCGAGACATCGACGAGTCGACTCAGCTCATGTAGCAGTATCGAGCACAG
24: ATGTCATAGCGTATGATGCTGCTATAGTATCGATATATGAGTCAGATCTATCTAGAGTGA
25: TGCTCATCATCTACACGTGAGCGTGTCGTGACTGTATATGACTGTGTGCAGTAGTCGCTC
26: TCATACTCTATACTGATATAGCATCTAGCTATGAGACACTGTACTAGACATGATGCTGCA
27: TGTAGCATGACGTGACAGATGAGATCGCGAGAGATCTGCATGAGACTATACACGTGATGA
28: TGATACAGATAGATCGCTCGCGACGAGCGTCGCTGACACATCGCTCACGCACACTCTGAG
29: CGAGCGACGCGACATGCGCAGCATCACTGACAGATCTGACAGTGCTATGTCTGACTCTAC
30: AGCACTCGAGATAGATCGCAGTACGCTACGTACTGCTCTCAGCAGCGAGTGTCTCTATAC
31: ATGAGTATGTAGCATGACATAGCATCGCTGTGTACAGATCAGATATCAGCTGAGCGTACA
32: TGTCAGCTACGCATGAGACATGTGTAGCGTAGCTCAGCACGACGACTAGTCTGAGTGTAT
33: GCGTACGCATCATGCACAGACGCAGCGAGCGACGTACTCATCATACTGTGACTCTCAGTG
34: AGTCTAGTCAGATCGATCGCGCTCGACTCTGTCTCGCTAGAGACTAGTCACGTGCGTGAG
35: TAGAGCAGTGATGCATAGACAGTAGCTATGCAGTGCATCACATGACGCGTGACTCTCTCT
36: AGTCTCGATACGCGCATACGAGTACGAGAGCAGCATGAGCTCGCACATACTCACAGCTGT
37: AGTGTCTATATCGCGTCTGCGATATATCATACACTAGTGTGTGCATGCGTAGATGTCGTG
38: TGAGATACATGAGCATAGCAGCGTATACTCGCGTGTGACTGTCGAGATGATAGTATACGC
39: ATGCATCGCGACGTCGATCTGTCATCTAGTGCATGTGATCTGACATGCAGAGCTGTAGTG
40: ACGATATACAGTACGCGATACGTATCGCTGCACTATGCTGATCTATATGCTCATGACGTA
41: GCGAGCGCTGAGTCACACACTATCACATAGCATCATAGTACTGCGTACTGATGATCTACG
42: CATGCAGCTGATGATGCTGATGCTGTACGCAGAGTGTAGCAGATATAGAGAGACTGATCT
43: GCAGTATGCTGAGAGCAGAGACTCTGTAGTCTCTCTCATACGACTGACAGTCTCAGAGAT
44: AGTGTCTACTATACGACTCTAGTCGTAGACTACAGCGTCAGTATCGTCGCTGTAGTCTCG
45: TGCATATGACACTCACGATGAGCTCAGTCAGACGTGCATGAGTGCGCAGATGAGCTGCAT
46: GCGACTCGTCGATAGCTCTCAGACTACAGCGCGCAGTCGAGTCTGCATAGAGTCTCACGA
47: TGCACGATATGATGTCATCATCGTGACAGTCGTCTGTCGCACGATATCTGCATGTCGCGC
48: TGCAGTATACGTGTCATCTCGCTGAGTCACAGCATGACTGTAGTAGATACGACTATACGA
49: TCGAGTACTGACTGTCAGATACATGCTATCTGACTGTGTGACTGTACACATGACGTATCA
50: TAGATACATGTGACACGAGTGTACACAGTAGCTGATGCAGACATGACAGAGCATCGCATG
51: ACGACGCTCTGCACAGCTATACGTGAGTGCGCATGCGACACTACATCGATCGCATATCTC
52: ACACGTCTCTGCGCTCTACGTAGCTCACGAGAGCTCATGCACTGCGTACTCTCACTGACG
53: TAGCATGTCATGATGCTGATGTGTGTGCAGTGCGTGTATAGCGATATGCGATCGACACGA
54: TCGTCACTCGCGTCTCATCTATCATGTCGTGTATGCTAGATGCAGAGATCTCACGTGACG
55: TGCATATGCTAGCATCATCACTAGATATGTCTATGCAGAGACTGTATGACAGTCGTCGTC
56: AGATACGCACAGTCTATCGTCGTAGTCTGACTCATCGCTGCATACGCTCACTCAGCAGCT
57: ACACGCATATCGAGAGCACGAGCACAGACGTGACGTGTCTCATGCAGCTATATATGCATG
58: CATCAGCGAGCGCAGATCTGACGACGATACATATGTCGCATCAGATCGAGCTCGCGATCG
59: CTCGCTCGCATCTCATCTCGTGAGTAGACGCTAGCTGCGCTGATGCAGAGTACACATATA
60: TGCGCAGACGTGATGCTAGAGTCGTAGCGATCTATGTGTGTCGTCAGTCTGAGTCTGTCT
61: CGCATAGATCGATCGTACTACTGTCAGCTCGAGATGTATAGACGTGTCACTCTACATACT
62: CTCGCGTGCGCTGCATCATGCTGAGTACATGAGCACACGCAGCTATGCACAGCTCTCATA
63: CAGCAGCGACTGTATGTGTAGAGCAGATGTCTGATCATCGTCATGACGTCTCATAGTCAC
64: GATACGATCAGTCGAGCTGCAGAGCTAGTCGACGCGTGTGCATATAGTCACTCGAGATCT
65: GTACGTGTGCGTGCGCAGCGTGTGCTCTATACACGTCACATCTCACATGTGATGTAGCA
66: TGATGACATGATCTCAGTAGTGCATCGATATACGCTAGCTCGAGTGACTCACATAGATGC
67: ATGCAGACGCGTAGTAGTCAGTAGCATGTATATGTATACAGCGCATATCAGCATCATCGT
68: CGTGTGAGTAGATCAGATACTAGTACTGAGATATAGCTGTGCTGCTCATACATGCGTATG
69: CGACACGCACTCACATGCTACTCTCGCTCTGTCAGCGCACTCATGCTCTGTGTCTCGCTC
70: ACGCATGTCATGATGCACGTCTGATACACTACACTGCGCACTCTAGACGCGATATCACTC
71: TAGTCTCTATGCAGACGCTGATACTAGTCTAGCGTCTGCATACGACAGAGACTCGTCGCG
72: ATCGTCGTGTACTACTGCATAGACTGTATCGTACACGAGATGTAGATAGTATACGCATGA
73: GATCAGTAGATACAGTGCGTACTCACTATGACACTGCATACTGCAGCTCGACTAGACTGC
74: AGACGATATCACACTCATCACGATCGTACGCAGTATCACTCTACTGTCATATGAGACATA
75: CTGCACTAGAGACAGAGCGATCACATAGATCGTCACGACAGCATGAGCAGCGATACGTAC
76: GTACGTACGTACGTACGCGTCTCTA

A Space

A collaborative video and installation work by Owen Griffiths and Vebjørn Guttormsgaard Møllberg. Working site-specifically with the architecture of the Art Academy and Charlottenborg, investigating the notion of collaboration, alternative learning spaces and their fragile existance within large institutions.

The artists would like to thank:

Pia Eikaas, Vladas Suncovas, Lucas Wichmann Melkane, Ingrid Forland, Benny Henningsen, Margarita del Carmen, Sidsel Carré, Fern Thomas, Nils Norman, Emma Hedditch, Stefan Pedersen, Pia Rönicke, Luca Frei, Syvende og Sidst, Troels Nøhr Holmstrøm, Jørn Tore Egseth, Freddy Cronqvist, Huw Griffiths, Marilyn Griffiths, Thom O’ Sullivan, Pia Rönicke, Henriette Heise and all former and present students and friends of Walls and Space participating in the video.

A voiceover:

Cloaked and curtained. Soft walls and fluidity held gently by a shape shifting choreography.

Things are at risk, things we celebrate and overlook and others have fought for. The spirit of friendship, dressing up, discussing, cooking, brewing, baking, reading making banners… these slow processes are the luxury of this space.

Climbing slowly, alongside the forming of collective decisions and processes, of fermentation, of rising yeast… the importance and risk of collaborative works are exposed.
Collaboration as a fragile agreement.
Throwing rocks in a safe space.
Testing our boundaries.
Collaboration as a radical action.
Peeling apples.
Reading out loud…

The narration of the space occupies the draws and cupboards we seldom open and explore but also extends to the furniture and curtains. Built and stitched by friends and colleagues…

Discarded clothes, saucepans, weighing scales and the tree in the middle of the table. These are the physical results and the props of this space.

Steam rises, papers move in the breeze…

Togetherness as liquid architecture.

Watering a plant.
Clearing a room.
A cleansing song.

Bodies moving in the space
Following instruction
Adapting to voice
Stretching out

A brief moment of meaning. Lifting each other, building a room.

Nurtured and steered collectively, we observe and learn and compromise.

Structure; tools of negotiation and roles of responsibility fall into place, the importance of how to talk and work together…

Conflict pulls at risk, fragile balance. Un-watered plants…compost, collapse
Break down…Adapt. Renew…

END

Primed linen. Disassembled. Reassembled.

Den ambitiøse avis Dagen, der udkom 40 gange i efteråret 2002, før de røde tal lukkede det, genopstår nu.

Webvirksomheden TrafikOptimering Aps har købt rettighederne til webadressen www.dagen.dk og begynder angiveligt fra midt i 2006 at lancere en webavis med nyheder og andet indhold. Det nye Dagen skal være en interaktiv internetavis med indhold fra kendte medier som for eksempel Reuters, Børsen, Berlingske, Politiken og Jyllands Posten.

TrafikOptimering ønsker at anvende samme logo og skrifttype som i den trykte udgave af Dagbladet Dagen. Det er kun selve bomærket, som TrafikOptimering overtager, hverken Dagens tidligere initiativtager, Peter Linck, eller andre af Dagens profiler har noget som helst med projektet at gøre.

Mind the Gap
– is a trigger warning.

Trigger warnings are meant for you to be alert, – there could be danger that you might otherwise overlook. “Mind the gap” are usually used at train stations, where, if you don’t (mind the gap) you will fall into the gap.
In this case.. you might just fall into a different world.

My stories are represented through my eyes and my references and my way of ‘speaking’.
I draw a lot from comics and fairytales. and these are especially inspired by the rawness and harshness of the Grimm’s collected fairytales that dealt with everyday situations in life, but also from comic book authors/authors such as Neil Gaiman, and his way of telling  often dark and twisted stories of people falling into cracks and having to deal with new and confusing worlds that might have danger lurking around the corner.
…and added to the pot, a  bit of Monty Python’s absurdity, perhabs..
..or perhabs that is all just my own little take on life..

Sometimes it is part of life to fall into the gaps, and, hopefully, get back up safely again before the train arrives.
It’s part of being human to fall sometimes.. and it’s also part of being human, to warn other people of the gap you just fell into, so that they may not do the same mistake.
However.. I invite you to fall into the gap I created and explore a different view of a (maybe not so) different world.
All the best wishes from inside the gap.

We fold them out.

They are so difficult to see, they are melting together with the background as we hold them up towards the light.

Still they can see us.

We bathe them, drown them almost. Try to keep them down but they surface. We want to clean them, reshape their every thread spun.

We haul them up; they are so heavy now, clinging to our bodies – becoming our clothes. Wrapping themselves around us like corsets. The water is cold when it reaches our skin.

They fall off, landing in messy piles at our feet. We collect them. Hang them up to dry. They turn stiff and solid. Visible again. In places there are brown circles, traces from the pools where the dirty water vanished last.

We hold them up against the light again. They are more opaque now, blocking out everything behind them. Except for where the holes are, they have become tiny little openings to peak through.

Whatever was, unmatters.

Installation view afgang 2015:

Scrolling directions changed.

When wanting to read further in a document or on a web page, instead of dragging the sidebar down, you now drag the whole document up, as if you would place your fingers on an actual piece of paper and slide it.

Even when not touching the screen itself but touching it via a touchpad or a mouse, the changing of scrolling directions will lead you to act as if you are touching the screen’s content manually and directly.

*

Among the earliest traces of human touch we find the hand stencils of cave art – a prototype of painting in which the touching hand is both motif and tool.

The touching hand is key also in finger flutings – a nonfigurative art form performed more than 10,000 years ago by adults and children sweeping their fingers in a soft substance, found in caves, called moon milk.

Here, the hand points to the trace of its own touch.

*

An early ritual of our desktop publishing ancestors was the process of creating type, and adding a drop shadow. Archeologists tell us that in the pre-PowerMac and pre-Pentium days of 1987, right after he created his first perspective checkerboard patterns, primitive DTP Man made history by creating text and adding a gradient fill behind it.

*

Film is a translation of object and world to the two-dimensional surface of the screen.

Even in a 3D film, the only things stretching out from the screen are the rays of light that collect in the film projector.

We notice the missing dimension when a head or a hand block the light of the projection.

Images:

1. Still from Eyes Touching Fingers Seeing (HD video 15 min, Amalie Smith 2015)

2. Hand stencils from Cueva de las Manos, Argentina

3. Finger flutings from the Rouffignac Cave, France 

4. Installation plan Charlottenborg

5. Still from Eyes Touching Fingers Seeing (HD video 15 min, Amalie Smith 2015)

Building a sound mobile.
I´m looking at a dancing body. With my hand I make a circular movement, letting the drumstick hit with a confident composure. I do it with a minimum of inner debate, just leading my hand over the drum-kit like its moving on its own. I want to create a scenario where the actions i make with my hands can have a conversation. Like bricks placed on top of each other, the audiable interactions build a structure that translates movement into sound. Each sound formation I make reflects a dance on the platform in front of me. In order to translate the movement into sound, I organize the moving images into a graphical notation system. I’m programmed to interpret these graphical punctuations as if I was navigating though a marsh field, with a map telling me when to turn and when to leave a noticeable mark for a possible return. And maybe there is a need for repetitive scratches on the ground, to be able to shape a groove.
I’m telling what I know in the vocabulary I have been given. Perhaps there is no other way to express what I want to say.

By Arne Skaug Olsen

Dear Lea

When you first told me about your project – to recreate your body in the image of the The Discobolus of Myron – an avalanche of things from my own backyard of interests came rushing into my field of vision; quite a few of them we discussed that night, in particular the complicated issue of dietary requirements and restrictions necessary for producing the ‘ideal’ body. I tend to initially explore a process through it´s particularities (like protein synthesis or lipid metabolism), however what strikes me is how rich this subject matter is in speculative possibilities. Trying to re-trace our steps now, we discussed Richard Wranghams investigation of fire as – metaphorically – a part of our digestive system and a prerequisite for the development of language; we talked about Vilhjalmur Stefanssons Advenures in Diet, his time among the Inuits as an anthropologist between 1906 and 1918, and how this informed his decision to undergo an experiment and for one year eat nothing than meat. Wranghams ideas are perhaps not as directly relevant to your effort to deal – quite literally – with ‘ideals’ as Stefanssons, but they tangentially touch upon a very relevant questions: Is it possible to imagine ideals without language, or is it precisely the ability to hand down knowledge from generation to generation through stories and mythologies that created this fantasy of something singular and perfect in its own right? It is a lovely thought, as Wrangham suggests, that the invention of fire was necessary for the invention of language and the subsequent development of tools and technology. This handing down of knowledge requires a complex set of interrelations between individuals, linking the body, the tool and language: instruction. In his essay Techniques of the Body, Marcel Mauss explores the body as a tool from an anthropological perspective, and shows how both cultural and natural circumstances has created widely different ideals. In one particularly personal paragraph, he describes how swimming instructions had changed during his lifetime. He writes in 1934 “… the habit of swallowing water and spitting it out again has gone. In my day, swimmers thought of themselves as a kind of steam boat. It was stupid, but in fact I still do this: I cannot get rid of my technique.” There is an order to things; which more or less sums up the concept of being instructed. However, to arrive at this order of things is more often than not a subscription to ideals that do or don´t make common or otherwise sense. It´s easy to see today that Mauss´ steam boat swimming technique is based on idealization of machines, modernity and progress – but certainly not on being effective or functional. Mauss was born in 1872 and would have experienced the Great Acceleration of technological and scientific development of the Modern age. However, the question of the human body as a tool is perhaps an even more interesting – and complicated – question today than when Mauss was developing his anthropology. Taking Graham Harmons reading of Heideggers tool-analysis in Being and Time into account, the question might be whether there is much sense in distinguishing between the body-tool and any other tool. In his tool analysis, Heidegger shows how a functioning tool withdraws from access, and it´s only when it´s broken that it presents it self. Harmon argues that this withdrawal is an essential property of things, which implies that most things don´t reveal themselves, to us or to themselves: “Idealism (…) is unworkable, since there exist real things whose core reality is withdrawn from access, even by themselves.” In his book Hyperobjects, Timothy Morton argues that there is a flatness to Harmons (object oriented) ontology that leaves little difference between a thing and a person (the tool or the body-tool), and practically no room for idealism. This opens up a vast philosophical playing field beyond Kantian correlationism that reveals the existence of hyperobjects – things much larger than the human scale. The problem of hyperobjects, Morton writes, “is not one that modernity can solve” and what we´re witnessing is the “Titanic of modernity hits the iceberg of hyperobjects” as he More importantly, this ontology brings with it a new ecological reality that simultaneously displaces humans (again) from the proverbial centre of the universe and gives us an appropriate role in a scale that is larger than before. We are just realizing that we´ve entered an epoch where humans have changed the planet at a magnitude that will be visible on a geological scale. Consider this: What´s the half-life of a human body? A matter of months? The half-life of a life lived? I think of a lifetime of accumulated waste and I shudder. To bring this back to your question, Lea, I believe that the concept of ‘ideals’ is highly anthropocentric, and it can be traced through evolution as a bi-product of tool making and language – and thus as a prerequisite for abstract thinking. This makes ideals and idealism questionable from an ecological point of view, (as well as from a philosophical) which I believe Harmon & Morton shows. As a vernacular concept, ideals are among the most problematic concepts out there. Especially when they deal with bodies, ways of being and living. The notion that there is only one solution to a problem – problems are notoriously complex – is not only nearly always wrong, it also does not take into consideration that there might not be a problem in the first place, only another ideal or sets of ideals that contradict each other. This is exactly the beef that Rancière has with Plato about politics – but that´s another conversation for another time.

In the beginning of this letter I tried to re-trace our first conversation about your project. I might have gotten lost on the way, but I hope you don´t mind. We can always start over.

Your friend,
Arne

Cape Town, April 27, 2015.
Conversation in a car.

By Moa Alskog

–   Look at that guy; he’s big!

A man in his late twenties sits behind the steering wheel of a maroon Opel Corsa Lite and points at the car in front of him. He points at a man sitting in the back with his arms stretched out over the back of the car seats.
– Look at how big he is. The man repeats when he doesn’t get a response.
– Who? Asks the woman sitting next to him. She looks up from her smartphone where she’s been skipping through Instagram-posts, follows the man’s gaze and confirms.
– He’s big. Like you were a year ago? She teases him.
– It’s still kind of sensitive.
– What does that mean? She continues, trying to smooth things over. Were you really fat?
– I was definitely more than chubby. At most I weighed like a hundred kilos. That was two years ago. But it’s been something I’ve struggled with since I was a child… I think it’s affected me more than I’ve realised.
– They talked about weight discrimination on a radio program* I listened to yesterday. Apparently you’re three times more likely to be discriminated against for being overweight than for other things like ethnicity, religion or gender. Three times!
She watches for his reaction, but he’s focusing on the road and doesn’t answer.
– Apparently people perceive overweight people as less intelligent, less    successful and even less happy. It’s like the halo-effect but the other way around.
– The halo-effect?
– It’s a theory that success is transmittable, which basically means that if you’re good at something, people are more inclined to think you’re good at other stuff too. Or if you’re seen with successful people you have a bigger chance of becoming successful yourself. Like when you were hanging out with R that time.
– What?
– Didn’t someone ask if they could take a selfie with you, just because you were hanging out with him?
– Ja. He stops the car at a red light. She bends down to find the sparkling water in her bag. It’s a hot day and the wind entering through the half open window doesn’t really help. They’re going to the beach, to “Bakoven” or the “bourgeois beach” as he jokingly calls it, because of its clientele – mainly white middle class.
– What happened to your six-pack plans? She asks as she opens the water bottle.
– I don’t know, I forgot about it. I should start working on it again though, my ex girlfriend K told me I’d look like a total babe if only I worked out my upper body.
She imagines him tanned, with a flat hard stomach, defined biceps and bulging breast muscles.

– You would look good, but don’t overdo it! I saw a guy at lunch yesterday – a bulldog. He had really big muscles and was covered in tattoos. The type that lives at the gym – not sexy! That’s how big he was.
– Just because you have intellectual aspirations and are satisfied with a soft, slouchy indie-body, that doesn’t mean everyone is also. The man snaps at her, smiling.
– I’m not soft and slouchy. I work out. Sometimes I run, but I’m trying not to be so conscious about my body. It’s a negating activity. I read an interview with Sylvester Stallone where he talks about his relationship to his body ‘I don’t want to put down working out, it’s good, but you become incredibly self-conscious. You are always aware of yourself; you are just aware of yourself. Do I look as good as I did yesterday? You are always looking for a reflection in windows and things. I don’t think there’s ever a moment, including when you are alone in your own house, when you are not constantly aware of every aspect of how you look’*
– Self-consciousness and insecurity, that’s what the man was oozing – the man I saw at lunch. Do you really think I look soft and slouchy?
– No.
– I have been thinking about it though, more than usual, my body. It started when I turned twenty-seven and I realised how close I was to thirty. I felt my ‘youth capital’ was expiring and that I had to compensate with a fit body to stand a chance in the sexual field.
– Are you kidding?
– I am. Or not actually, I’ve been thinking about it quite a lot lately. In moments of weakness I even think that men my own age will find me unattractive. It’s as if the line from that Godard movie, Le Petit Soldat got stuck in my mind. You know when Paul says to Veronica that in his opinion ‘women shouldn’t grow older than 25′.
She looks at the palm trees lined up on the side of the road, at their leaves being pulled in the direction of the wind, and at the succulents with fat, water filled leaves, and asks;
– Are you attracted to older women?
– Yes, I guess I could be, if they’re well kept.
– I am. I’m attracted to older men. Obviously, I’ve only ever dated older men. I don’t think the body is that important. The last guy I dated had the beginning of a beer belly and a sunken chest. But his personality made up for it; he was interesting, funny and smart, so…
– Is that the old guy you told me about?
– He was only ten years older than me. Yeah I guess that helped. I felt flattered.
– Because of his age?
– Not really the age, more that he was an established and successful man who “chose” me. Somehow it gave me better self-confidence both professionally and sexually.
– Ok, so you exchanged your youth and beauty for social status.
– I did really like him.
She pauses.
– But, yes it was horribly stereotyped. It did turn me on, both the fact that he was “smarter” and older than me. I think it made me feel more comfortable in my own body, as if my youth, or his age made me more attractive by default. Isn’t that far out, that we, or I, both the man and the woman are looking at the woman’s body? As if we’re sitting in a cinema watching a Hollywood movie.
– What do you mean?
– That in ninety percent of the movies I’ve seen, the woman is the object of desire, seen from a male perspective, which becomes your perspective as well. At least I think it’s fucked me up.
– You think that’s the reason women want to date older men? Because they’re objectified.
– I don’t think it’s THE reason but I think it’s a cultural construction. I saw an interview with an older poet recently, an eccentric and talented 60+ woman. She’d given up the thought of meeting someone. She didn’t think it was realistic. And maybe it wasn’t. Probably she is difficult to live with, and probably not prepared to adapt herself to take care of some man. But I couldn’t help thinking that, had she been a man, adaptable or not, 25 year-olds would’ve queued up to take care of that ageing eccentric poet.
– And maybe there are? Maybe she’s just not interested in hanging out with 25 years old boys? Maybe she’s like you, she’s only turned on by intellectually challenging conversations? Maybe she wants an older partner and now they’re all dead.
– No doubt. But why doesn’t that seem to be a problem for older men? I mean, aren’t they interested in intellectually challenging relationships? Aren’t they aware of their aging, increasingly unattractive bodies? Are they all descendants of the Marquis the Sade, who thinks an old and deformed man’s sole concern should be to enjoy himself with no concern for his object of desire? Because it wouldn’t bring him any more pleasure to bother? *
– No! He exclaims and laughs. I think a lot about my body! I’m also afraid of not being able to perform or not being attractive enough and I’m a man. Men’s bodies are also sexualised and objectified.
– But not at all to the same extent as women’s. But maybe you’re right. Maybe it’s a generational question. Western culture has in general become more about “being seen”. Susan Faludi writes in her book Stiffed that personal worth is judged in ornamental terms today. She says somewhere in the book that even traditional craftsmen and community builders must answer to the questions: Are you “sexy”? Are you “known” have you “won”? ** And that was during the 90s.
– Is that really something new? People have always wanted to be sexy and famous.
He indicates and turns left into a narrower road. White terrace houses pass outside their windows, surrounded by high fences and with signs warning trespassers of prosecution and armed response. The road is almost empty. It’s three o’clock and people are still at work. He looks through his CDs and puts one in the stereo. The soft voice of a smooth faced man streams out of the speakers:

Sometimes it feels like heaven
Sometimes it feels like hell
But you keep on going
Till it’s hard to tell*

– Maybe you’re right, but it has gotten increasingly important in modernity says the woman.
– What?
– Physical attractiveness.
– Ok.
– It’s become one of the most important factors when choosing a mate, both for men and women. At least according to this sociologist** I’m reading. She means that our sense of social worth has become increasingly tied up with love and the family theses days. One of the main reasons for this is that we’re no longer born into our social status, as we were in pre-modernity, which means it’s something we constantly have to negotiate with others. In a society that’s both competitive and one in which we’re always being evaluated, love becomes a place where hopefully you can step back from all of that and where you are the winner of the contest, the one and only! It has a validation function in society it didn’t have before.
– What’s that got to do with physical attractiveness? You don’t choose your partner only because she or he is good-looking?
-Not only. But according to her people do base their choice to a high degree on physical attractiveness and personality. Because these are qualities that you’re presented with immediately and they’re seen as a reflection of a person’s inner “essence”. Whereas in pre-modern times you depended on more ‘objective’ values like status and wealth. Then it was a more collective than subjective act to choose a partner.
– Okay, you would think people thought more of education and career and stuff.
– Apparently not. But I guess if you’re successful in other areas –your feeling of self worth isn’t as dependent on “being loved”. Because you have other ‘capital’ than a nice personality and sexiness to rely on.
– Like what, work?
– Not necessarily. Hannah Arendt says that self-worth has something to do with having a voice and a role in the public sphere, about being an active member of a community, defending values and standing for those values publicly*. I think that’s right… Franz Fanon writes in his book Black Skin, White Masks how he becomes conscious about his body when moving to France in the 50s “In the white world the man of colour encounters difficulties in the development of his bodily schema. Consciousness of the body is solely a negating activity. It’s a third person’s consciousness. The body is surrounded by an atmosphere of certain uncertainty” **
He talks also of black men and women wanting to ‘become white’ by being getting together with a white woman or man. As I understand, to get a form of validation, or recognition. If you have a voice in the public space, if people listen to you, you’re recognized already, which makes you more comfortable in your body.
I mean, in comparison, look at the group of “white middle class men”. It’s the only group that can be totally unaware of their body and get away with it and even be considered as sexy!
– Really?
– Yeah. Look at Leonardo Dicaprio and his ‘dad-bod’, his seal-like body type that became a trend after he was photographed on a boat surrounded by ‘Victoria’s Secret’ models…
– With ‘mom-bod’s’. The man adds. He laughs.
– I wish!

The car slows to stop. She rolls up her window and puts on her cap. He parks at the usual spot along the road. They step out into the sun, cross the road and walk towards the staircase leading down to the beach. The sky is cloud-free and the sand white and warm. Boulders are spread along the shore. Other than that there’s no land in sight. They leave their things on the sand and head towards the sea with the song from the car still in their ears:

“Sometimes it feels like heaven
Sometimes it feels like hell
But you keep on going
Till it’s hard to tell. 

             And your body moves like the grace of an archangel
              Like a stroke of genius from Ra-a-phae-el”
                To dodo to dodo to dodo to dodo

P.1 * ’När utseendet står i vägen’ ”Tendens” Sveriges Radio, Marts 10, 2015, http://sverigesradio.se/sida/avsnitt/514422?programid=3381

P.2 * Susan Faludi, ”Stiffed – The Betrayal of the American Man” p.583, (New York, HarperCollins, 2000)

P.4 * The Marquis de Sade ”Justine” p.139 (UK, Oxford university press, 2012)

”Solitary pleasures, then, do have some charms, and can do so more than any others. If this were not so, how could so many old or deformed men enjoy themselves? They are quite sure that no one loves them, quite certain that it is impossible for others to share what they feel – do they experience pleasure any the less? Do they want to experience only the illusion of it? They are completely selfish in their pleasures, and it is obvious that their sole concern is how to enjoy them, that they are prepared to sacrifice anything to obtain them, while the object that serves them is never expected to possess any properties but those of passivity”

** Susan Faludi, ”Stiffed – The Betrayal of the American Man” p.598 (New York, HarperCollins, 2000)

P.5 *’’Rafael‘ The Hanging Gardens of Beatenberg, 2014, Beatenberg, https://www.youtube.com/watch?v=UUmp12sUGVs

**Eva Illouz, ’Why Love Hurts: A Sociological Explanation’ (Wiley, e-book, first edition 2012)

P.6 * Quote from ’An interview with Eva Illouz’ by Jessa Crispin, http://www.bookslut.com/features/2012_07_019157.php

**Franz Fanon ”Black skin, white masks” p. 83 (English translation Grove Press inc. 2008, originally published by Editions de Seuil, 1952)

Photos by Pia Eikaas

INSTITUTIONERNE ER I KRISE. MILJØET ER UNDER FORANDRING: MILJØET
LIGNER IKKE SIG SELV. INSTITUTIONERNE ABSORBERER UDEFRAKOMMENDE
FORSTYRRELSER: DETTE VIL STYRKE INSTITUTIONERNES GRUNDLÆGGENDE
IDENTITET: MILJØET IMPLEMENTERES; FORSKELLE OPLØSES I GENSIDIG
IDENTIFIKATION; INSTITUTION OG MILJØ ER ÉT.

The room was empty (it would later be filled with drums and unorthodox fashion) apart from the man in shadows at the other end of an seemingly ever expanding room. Facing west and turning north I followed him into a different room. This room was not empty, but it was seat-less. No four legged creatures on which to rest ones exhausted legs, the indoor climate so inherently unpleasant.

The room was lit and on the floor there was something unseen, or rather, it was just out of sight, hidden under what it was carrying, something heavy, making it seem weightless and hovering over the parquet. It was carrying metal; heavy, solid, shining.

The man who led me there was still in the room, looking somewhat nervous. He looked at the almost solid metal blocks. He could see that the blocks were not complete hyper-rectangles; there were recognizable images cut in the blocks. Reliefs. He could still see shimmers of other potential casts and stoneware reliefs, discarded due to practical conditions.

Now, the reliefs were cut in aluminium; a perfect compromise, and possibly a better solution. Their beginning was binary, set in order by software and complex bio-chemistry. High powered light beams shaped the aluminium into figurative layers. Aluminium, a metal with local pedigree, space age usability and biological hostility.

The relief on the right looked like a stylized jungle, with a sun and a snake. A detail of a 3d wire-frame, a draft of the relief, would have looked something like this:

When he looked at the relief, he was reminded of the sort of jungle that The Black Girl would beat her way through in search of truths and God, as told by an Irishman and illustrated by an Englishman, or maybe a primeval forest?

The second relief portrayed a man holding a book in one hand and a piece of paper in the other, and in the background, there were buildings, some symbols and what resembled a rocket being launched. The rocket was a distinct rocket shape, like the one in Tintin or the V2’s fired from Penemünde; famous for their screaming destruction of London. And the screaming coming across the sky; opening a famous American death-cult tech paranoia detective novel.

One of the only things I could remember from classical studies was the ionic pillar. So of course there was such a thing in the second relief.
The other man saw both potential and death in the second relief. He was familiar with the reference points in both style and symbols. The knifed edge of technology that could erupt so quickly, made him believe that, we could be standing at the threshold of a childhoods end; something that would definitely destroy the current human condition.
‘… continuity of our spiritual existence after death’ , or at least a symbolic death.

Looking at the third and last relief, I felt the momentum of the implied narrative. I felt, and I knew he felt the same thing, the ideas of a certain Jesuit’s spiritual concepts concerning human potentials, which the Jesuit thought would lead to the gods-head, or maybe less theologically, the Omega Point, Star Maker, UI, AC or similar. We were imagining being taken by our hands, while standing on a hill top, and sent traveling through time/space, and from a distance, we would watch how amino-acids in rapid haste evolve into primitive life, evolving into intelligent life, evolving; for me and him and us, into a incomprehensible life, evolving further into light/energy/eternity in the same plane as an imagined state of Absoluteness. That was the ambitious plane of the reliefs, positive potentials from contemporary fears.
It was three figures holding hands in an undetermined space, with stars and impossible mechanics as their only witness; a last and a first.

Kasper Holm Jensen, 2015

E A R T H  C O O L I N G  A I R C O N D I T I O N I N G

A long pipe is buried in the small backside garden of Kunsthal Charlottenborg.
It is open in each of its ends.
The pipe divides into two smaller pipes, which prolongs for 24 meters under the ground at 1 meter of depth.
It goes back up to the surface of the ground, up along the wall and through a window into the building.

Earth has in itself an isolative function, which makes the temperature underground differ from the temperature above ground. Trees and plants are holders of cool humidity on the surface of their roots. These conditions generate a cool underground environment, which is able to exchange heat for cold temperature in the hot seasons and cold for hot temperature in the cold seasons.

On the inside of the building, the heat can be overwhelming some summers, much warmer than outside. When this high temperature rises and heats up the end of the pipe inside the building, it makes the cooled air from underground move, it pulls it up into the building. When the heat gets intensified, so does the airflow inside the pipe. When the days are colder, the circulation of air decreases.

A E R O T O P O

The whole body remembers – not only the brain with its nervous system does, but the skin and the organs, the muscles and bones. We remember the sight of a space along with its temperature, its tones in sound and colour, an associated emotion, a smell. We relate images of other spaces to this space and then, a new map displays itself.

The body learns and adapts with intuition, mistakes, emotions, corrections among other. Unwillingly, subjectively… The body imitates and takes shapes from its surroundings. The body codes information in its nervous system, the body repeats and creates in infinite variations codes of emotions of a space. The contingencies are laid out there in this multidimensional map.